itgav

Ensembl ID:
ENSDARG00000006314
ZFIN ID:
ZDB-GENE-060616-382
Description:
integrin alpha-V [Source:RefSeq peptide;Acc:NP_001028893]
Human Orthologue:
ITGAV
Human Description:
integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) [Source:HGNC Symbol;Acc:61
Mouse Orthologue:
Itgav
Mouse Description:
integrin alpha V Gene [Source:MGI Symbol;Acc:MGI:96608]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31703 Nonsense Available for shipment Available now
sa41365 Nonsense Mutation detected in F1 DNA During 2017
sa34569 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044314 Nonsense 110 1045 3 30

The following transcripts of ENSDARG00000006314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 11922213)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11674778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTCTTGTTTTTTCCCCGTCACAGATGACAGAAAGCATTCCAATGGA[C/T]AGCAAATGGAGTTTAAGTCAAATCAATGGTTTGGTGCCACTGTGCGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044314 Nonsense 371 1045 12 30

The following transcripts of ENSDARG00000006314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 11904306)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11656871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAACTCACCGGCTCCGAGATCTATGCTCGATACGGAAGCTCAGTCTG[C/A]AGCGTGGGAGACCTTAACATGGACGGATATAACGGTATCATTTTGACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044314 Essential Splice Site 637 1045 20 30

The following transcripts of ENSDARG00000006314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 11892445)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11645010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGATCTCCGTGTGCATCTGTCCGTTTGATGTTCTTTTTCTTGCACCA[G/T]TGACCAGAACGAGATCTACATAGGTGACGACAACCCACTGACCCTGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link