ptpn18

Ensembl ID:
ENSDARG00000006308
ZFIN ID:
ZDB-GENE-050320-12
Description:
tyrosine-protein phosphatase non-receptor type 18 [Source:RefSeq peptide;Acc:NP_001013470]
Human Orthologue:
PTPN18
Human Description:
protein tyrosine phosphatase, non-receptor type 18 (brain-derived) [Source:HGNC Symbol;Acc:9649]
Mouse Orthologue:
Ptpn18
Mouse Description:
protein tyrosine phosphatase, non-receptor type 18 Gene [Source:MGI Symbol;Acc:MGI:108410]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41126 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014323 Essential Splice Site 460 513 None 17
ENSDART00000109357 Essential Splice Site None 221 None 15
ENSDART00000132158 Essential Splice Site 461 514 None 17

The following transcripts of ENSDARG00000006308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 10188929)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9605511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTTTGTTAAGTTGTTAAACACTGTTAAATATATATTTCTTTTCCTC[A/T]GCTGAAAGCCAATCGTCTACAGATGATGATTATGAATACGTGTCTAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link