si:ch211-176f1.1

Ensembl ID:
ENSDARG00000006301
ZFIN ID:
ZDB-GENE-070912-156
Description:
Novel protein similar to human Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 (RAPH
Human Orthologue:
RAPH1
Human Description:
Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 [Source:HGNC Symbol;Acc:14436]
Mouse Orthologue:
Raph1
Mouse Description:
Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 Gene [Source:MGI Symbol;Acc:MGI:1924

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31706 Nonsense Available for shipment Available now
sa8384 Nonsense Mutation detected in F1 DNA During 2017
sa34583 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38727 Nonsense Mutation detected in F1 DNA During 2017
sa34582 Nonsense Mutation detected in F1 DNA During 2017
sa38726 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061156 Nonsense 19 1346 1 14
ENSDART00000146597 Nonsense 19 670 1 13

The following transcripts of ENSDARG00000006301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14148113)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13900678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGTTTTCAGATGACGAGCTGGATCATGCTGCGGAGGAGGACAGCGAT[A/T]AAGAGGACCAGGACTTGGACAAAATGTTTGGAGCGTGGCTTGGAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061156 Nonsense 71 1346 2 14
ENSDART00000146597 Nonsense 71 670 2 13

The following transcripts of ENSDARG00000006301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14147610)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13900175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGACAAGATTCAAACATGGCCAACATGGCCTACCGCTTCTCCGTTTA[C/A]AACATCAACGGTGAGGTCACACAGTACAATACAAGATGCTTCATTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061156 Essential Splice Site 562 1346 11 14
ENSDART00000146597 Essential Splice Site 583 670 11 13

The following transcripts of ENSDARG00000006301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14098295)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13850860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATGTCAGAATGCTGCATCAGTGGGTCAACGGAATACGCATTGCCAAG[G/A]TTTCAGCTTATAATATGATAACCCTCTTTAAATAATGTGTATTGCTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061156 Nonsense 830 1346 14 14
ENSDART00000146597   None 670 None 13

The following transcripts of ENSDARG00000006301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14092748)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13845313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTATCTACACAGTAACGGATATTTGCCTCCACCACCACCCCCAGAA[C/T]AGTTAAAATATCCACCTCCCCTCAGTACCAATGGGCTCCAACAATTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061156 Nonsense 1128 1346 14 14
ENSDART00000146597   None 670 None 13

The following transcripts of ENSDARG00000006301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14091853)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13844418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTCCAAGGAGTCTTCTCGGGCACTAACAAAACCAGGCAAGATCAACT[T/G]AGCTAATCTGCCCTTGGCTCTACAGGGGAGGCAAAGTCACTGTCGTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061156 Nonsense 1190 1346 14 14
ENSDART00000146597   None 670 None 13

The following transcripts of ENSDARG00000006301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14091668)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13844233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCATCAGAACTGCACATTGGGGCTCCCAAAGTGGCTGTGGTGAACCCA[C/T]AACCCCAGCATTCCTCCAGCTCCACATCCTCATGGAAGCAGAGCTCCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link