arhgef7a

Ensembl ID:
ENSDARG00000006299
ZFIN ID:
ZDB-GENE-060322-11
Description:
Rho guanine nucleotide exchange factor (GEF) 7a [Source:RefSeq peptide;Acc:NP_001116707]
Human Orthologue:
ARHGEF7
Human Description:
Rho guanine nucleotide exchange factor (GEF) 7 [Source:HGNC Symbol;Acc:15607]
Mouse Orthologue:
Arhgef7
Mouse Description:
Rho guanine nucleotide exchange factor (GEF7) Gene [Source:MGI Symbol;Acc:MGI:1860493]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9534 Essential Splice Site Available for shipment Available now
sa8972 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13978 Essential Splice Site, Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045093 Essential Splice Site 649 861 16 23
ENSDART00000141408 Essential Splice Site 648 858 16 22

The following transcripts of ENSDARG00000006299 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 22595173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCCAGCGCCTCCACTCAGGCCCTCAGCTGCTCTCTGTTATAAAGAGG[T/A]ATTRTAAYTTCCACTTACAAATTTAAAATTAGGTATGCAAATATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045093 Essential Splice Site 711 861 19 23
ENSDART00000141408 Essential Splice Site 710 858 19 22

The following transcripts of ENSDARG00000006299 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 22597189)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTCATATGATTTAAYGCCCCTCTCATCCRTGACCGGACGGCCTCCTC[A/G]GCATGGCAAGGCACTGATCTCATGCACAACCACGTTTTGGATCAGTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045093 Essential Splice Site 828 861 22 23
ENSDART00000141408 Splice Site 819 858 22 22

The following transcripts of ENSDARG00000006299 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 22599400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTGATATKTYTGTTTCCTAGTTAACRGATTTTAACCTTTCAACAGGA[C/T]TATAAAAAAATGAAAAAATCCCTGGAGGAAGAACAGAGAGCTCGGAAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wx2m4mwg