prdm5

Ensembl ID:
ENSDARG00000006288
ZFIN ID:
ZDB-GENE-040708-1
Description:
PR domain zinc finger protein 5 [Source:RefSeq peptide;Acc:NP_001002301]
Human Orthologue:
PRDM5
Human Description:
PR domain containing 5 [Source:HGNC Symbol;Acc:9349]
Mouse Orthologue:
Prdm5
Mouse Description:
PR domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1918029]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37594 Nonsense Available for shipment Available now
sa24242 Nonsense Available for shipment Available now
sa31079 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14875 Nonsense Available for shipment Available now
sa7503 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Nonsense 109 634 4 16
Genomic Location (Zv9):
Chromosome 23 (position 2047085)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2015180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCTGTGTGTGTGTGTGTGTGTTCACAGGATGGAGAGAATATCTTTTA[T/A]CTGGCGGTTGATGACATCGAGACGGACACGGAGCTGCTGATTGGTTACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Nonsense 155 634 4 16
Genomic Location (Zv9):
Chromosome 23 (position 2046949)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2015044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGAGCAGGACATCAAAGATGAAGACGAGAACAGTAAAGACAGCAAA[C/T]AACTCAGTGCAGACACAGGTGTGTGTTCAGTGGCTCTCTAAAGGCCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Essential Splice Site 161 634 5 16
Genomic Location (Zv9):
Chromosome 23 (position 2043660)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2011755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAGCTCATATAGTTCACCAATGTGTGTGTGTGTGTGTGTGTGTGTGT[A/G]GAGCTGATGATCAAAAAGGAGGATTACCCATGTCTGCTGTGCGAGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Nonsense 347 634 9 16
Genomic Location (Zv9):
Chromosome 23 (position 2027417)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1995512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAAGTTCATCTCCACCAATCAGCTGAAGAGACACATGATCACACAYT[C/A]AGGTAAATTCACACACTAGTAAAGGTGATGATACACAGGCGACTTTAMAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Missense 467 634 12 16
Genomic Location (Zv9):
Chromosome 23 (position 2009948)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1978043
KASP Assay ID:
554-4281.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCAACGTGCACATTCARGTGGTTCACGACGGACACAAGAAGTACAAGT[G/A]TGACCTGTGTGAGAAGGCCTTCGTCACGCCGTCYGTGCTCAAGAGCCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link