MYH11 (2 of 2)

Ensembl ID:
ENSDARG00000006281
Description:
myosin, heavy chain 11, smooth muscle [Source:HGNC Symbol;Acc:7569]
Human Orthologue:
MYH11
Human Description:
myosin, heavy chain 11, smooth muscle [Source:HGNC Symbol;Acc:7569]
Mouse Orthologue:
Myh11
Mouse Description:
myosin, heavy polypeptide 11, smooth muscle Gene [Source:MGI Symbol;Acc:MGI:102643]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20079 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18760 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 750 1961 18 40
Genomic Location:
Chromosome 3 (position 36495429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAACCTATCTTACCCTTGATGACAATTTCTCCCTGTTTTATGAACATC[A/T]GATTAAACATCTAGACTTGGACCCAAACCTGTATCGGATTGGTCTGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 1926 1961 40 40
Genomic Location:
Chromosome 3 (position 36505081)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATCGTGTTTGGAGACAAGTGGATTCTTAGTATCCTTTATGTTCCTCA[G/T]GCGTGGCAGTGATTCATCCTTCAGCACACCATTAAGGCGTAGCGCTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6ywtict1