MYH11 (2 of 2)

Ensembl ID:
ENSDARG00000006281
Description:
myosin, heavy chain 11, smooth muscle [Source:HGNC Symbol;Acc:7569]
Human Orthologue:
MYH11
Human Description:
myosin, heavy chain 11, smooth muscle [Source:HGNC Symbol;Acc:7569]
Mouse Orthologue:
Myh11
Mouse Description:
myosin, heavy polypeptide 11, smooth muscle Gene [Source:MGI Symbol;Acc:MGI:102643]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38402 Nonsense Mutation detected in F1 DNA During 2016
sa20079 Essential Splice Site Available for shipment Available now
sa33243 Essential Splice Site Available for shipment Available now
sa33244 Nonsense Available for shipment Available now
sa26113 Nonsense Mutation detected in F1 DNA During 2016
sa18760 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Nonsense 50 1961 1 40
Genomic Location (Zv9):
Chromosome 3 (position 36482606)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36566498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGTGTGGATTCCCTCAGAAAGGGATGGTTTTCAGTCAGCCAGCATT[A/T]AAGAAGAGACGGGGAATGAGGTGGTGGTGGAGCTGGACAACGGGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 750 1961 18 40
Genomic Location (Zv9):
Chromosome 3 (position 36495429)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36553675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAACCTATCTTACCCTTGATGACAATTTCTCCCTGTTTTATGAACATC[A/T]GATTAAACATCTAGACTTGGACCCAAACCTGTATCGGATTGGTCTGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 883 1961 20 40
Genomic Location (Zv9):
Chromosome 3 (position 36497847)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36551257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGAAGTCTGAAACGGAACTAAAGGAGATCACACAGAAACACGACCAG[G/A]TAAAGTCAGATCAAAAATGTGACACAAACTCAGCCGTAATTACTATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Nonsense 1643 1961 33 40
Genomic Location (Zv9):
Chromosome 3 (position 36503603)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36545501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAGACCAGGTTGATGTAAACAGCAGAGCGAGGGATGAGGCCGTTAAA[C/T]AACTCCGAAAGATTCAGGTCAGAAAGATAACTCTTCAAATTCTTTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Nonsense 1916 1961 39 40
Genomic Location (Zv9):
Chromosome 3 (position 36504891)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36544213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTCAGAAAGAGCTGAATGAGGCCATCGAGGCCAACGATGCCCTGAGC[A/T]GAGAAGTTTCCTCACTCAGGAGCAAACTCAGGTTGTTCTGAAGTGACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 1926 1961 40 40
Genomic Location (Zv9):
Chromosome 3 (position 36505081)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36544023
KASP Assay ID:
2259-3809.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATCGTGTTTGGAGACAAGTGGATTCTTAGTATCCTTTATGTTCCTCA[G/T]GCGTGGCAGTGATTCATCCTTCAGCACACCATTAAGGCGTAGCGCTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link