irf2bp2b

Ensembl ID:
ENSDARG00000006275
ZFIN ID:
ZDB-GENE-040426-2574
Description:
Interferon regulatory factor 2-binding protein 2-B [Source:UniProtKB/Swiss-Prot;Acc:Q7T2G1]
Human Orthologue:
IRF2BP2
Human Description:
interferon regulatory factor 2 binding protein 2 [Source:HGNC Symbol;Acc:21729]
Mouse Orthologue:
Irf2bp2
Mouse Description:
interferon regulatory factor 2 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2443921]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10664 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003425 Nonsense 340 501 2 2
Genomic Location:
Chromosome 11 (position 45571339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGCCACCGCCGTGCAGAACAGCCAATCGCCGATGGCTGCRCTCATAT[T/A]GGCGGCGGATAAYGCTGGCACAGGTTCAYCGAAAGACGCCGGTAATCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Life threatening arrhythmia: Genome-wide association of implantable cardioverter-defibrillator activation with life-threatening arrhythmias. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6e3fs4b2