mpp5a

Ensembl ID:
ENSDARG00000006272
ZFIN ID:
ZDB-GENE-020712-1
Description:
MAGUK p55 subfamily member 5-A [Source:UniProtKB/Swiss-Prot;Acc:Q8JHF4]
Human Orthologue:
MPP5
Human Description:
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) [Source:HGNC Symbol;Acc:18669]
Mouse Orthologue:
Mpp5
Mouse Description:
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15209 Essential Splice Site Available for shipment Available now
sa2908 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa15209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014306 Essential Splice Site 437 703 9 15
ENSDART00000084501 Essential Splice Site 437 703 7 13
ENSDART00000136167 Essential Splice Site 437 703 8 14
Genomic Location:
Chromosome 17 (position 34398322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAYAGAGAWGGGGAWGAAGACAACCAGCCTCTTGCTGGCCTCGTCCCTGG[T/C]ACTATGWTTTTACATGCTGTTGTGCTGTTTTTTTTTTTTTTTTCTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2908
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014306 Essential Splice Site 484 703 11 15
ENSDART00000084501 Essential Splice Site 484 703 9 13
ENSDART00000136167 Essential Splice Site 484 703 10 14
Genomic Location:
Chromosome 17 (position 34398643)
KASP Assay ID:
554-2827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAAGAAGAAGCGGAAGAAGATGCAATACAATGCTAACAAAAATGATG[G/A]TGAGTGTCTTCAGGCAAACATTAGAGTAAACTACWCACCTTTAAAACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/48gobi9h