mpp5a

Ensembl ID:
ENSDARG00000006272
ZFIN ID:
ZDB-GENE-020712-1
Description:
MAGUK p55 subfamily member 5-A [Source:UniProtKB/Swiss-Prot;Acc:Q8JHF4]
Human Orthologue:
MPP5
Human Description:
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) [Source:HGNC Symbol;Acc:18669]
Mouse Orthologue:
Mpp5
Mouse Description:
membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15209 Essential Splice Site Available for shipment Available now
sa2908 Essential Splice Site F2 line generated During 2016
sa36468 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014306 Essential Splice Site 437 703 9 15
ENSDART00000084501 Essential Splice Site 437 703 7 13
ENSDART00000136167 Essential Splice Site 437 703 8 14
Genomic Location:
Chromosome 17 (position 34398322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAYAGAGAWGGGGAWGAAGACAACCAGCCTCTTGCTGGCCTCGTCCCTGG[T/C]ACTATGWTTTTACATGCTGTTGTGCTGTTTTTTTTTTTTTTTTCTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2908
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014306 Essential Splice Site 484 703 11 15
ENSDART00000084501 Essential Splice Site 484 703 9 13
ENSDART00000136167 Essential Splice Site 484 703 10 14
Genomic Location:
Chromosome 17 (position 34398643)
KASP Assay ID:
554-2827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAAGAAGAAGCGGAAGAAGATGCAATACAATGCTAACAAAAATGATG[G/A]TGAGTGTCTTCAGGCAAACATTAGAGTAAACTACWCACCTTTAAAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014306 Nonsense 663 703 15 15
ENSDART00000084501 Nonsense 663 703 13 13
ENSDART00000136167 Nonsense 663 703 14 14
Genomic Location:
Chromosome 17 (position 34405922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGCTGCGAGACATTATCGAGAAGGCCCGAGAGATGGAGCAGAACTA[C/A]GGCCACCTGTTTGATGCTGCCATTGTGAACACCGACCTGGACAAATCCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link