ell2

Ensembl ID:
ENSDARG00000006251
ZFIN ID:
ZDB-GENE-030131-1717
Description:
elongation factor, RNA polymerase II, 2 [Source:RefSeq peptide;Acc:NP_001077281]
Human Orthologue:
ELL2
Human Description:
elongation factor, RNA polymerase II, 2 [Source:HGNC Symbol;Acc:17064]
Mouse Orthologue:
Ell2
Mouse Description:
elongation factor RNA polymerase II 2 Gene [Source:MGI Symbol;Acc:MGI:2183438]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23869 Essential Splice Site Available for shipment Available now
sa37248 Nonsense Available for shipment Available now
sa8757 Nonsense Mutation detected in F1 DNA During 2016
sa23870 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404 Essential Splice Site 60 132 None 10
ENSDART00000102408 Essential Splice Site 60 655 None 12
ENSDART00000130635 Essential Splice Site 80 635 None 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10178315)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11661678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCACCGTCCACACAGGCGACGATACGATTTCAGGGTCTTCAAGGGG[T/A]AAGTTCAGTTCATGTTAAATTGTAAAAACTCATCTAATTGCAGTATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404 Nonsense 79 132 3 10
ENSDART00000102408 Nonsense 79 655 3 12
ENSDART00000130635 Nonsense 99 635 4 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10183092)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11666455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATTCCAACCACAGAGGCTTCCGATGGCTCTCATAACTTCAACTTTTA[T/G]CTGTCCAACTTTGGCAAAGACAATCCTCAAGGAAGCTTCGAGTGTATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404   None 132 None 10
ENSDART00000102408 Nonsense 543 655 9 12
ENSDART00000130635 Nonsense 522 635 12 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10193542)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11676905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGCCTGTCAATAGCACTGAACTTCCAGCCCCAACTAAGCCTGATTA[C/A]ATAAGGTGAGTGAACTTTGACTCCTCTGGAAAGGAAAACTGTTTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404   None 132 None 10
ENSDART00000102408 Essential Splice Site 617 655 11 12
ENSDART00000130635 Essential Splice Site 597 635 14 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10196541)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11679904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGGAAGTGCATGAACAGGTGCTGCAAGAATATAAAAAAATTAAACAA[G/A]TGAGTGTAACTGAGCACGTCTAACCCATCTGGTCTTTTAAACAAACCTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link