brms1la

Ensembl ID:
ENSDARG00000006235
ZFIN ID:
ZDB-GENE-050913-49
Description:
Breast cancer metastasis-suppressor 1-like protein-A [Source:UniProtKB/Swiss-Prot;Acc:Q4V8V1]
Human Orthologue:
BRMS1L
Human Description:
breast cancer metastasis-suppressor 1-like [Source:HGNC Symbol;Acc:20512]
Mouse Orthologue:
Brms1l
Mouse Description:
breast cancer metastasis-suppressor 1-like Gene [Source:MGI Symbol;Acc:MGI:1196337]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36351 Nonsense Mutation detected in F1 DNA During 2017
sa23015 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003418 Nonsense 133 323 4 10
ENSDART00000131564   None 78 None 3

The following transcripts of ENSDARG00000006235 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 12622514)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12605036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCAGGTATCTACAGGGAGTTGTGTTTGGAGTCAGTGAAGAATAAATA[T/G]GACTGTGAAACCCAAGCAGCGTTCCAGCACTGGGAGGTGAGATATACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003418 Nonsense 142 323 4 10
ENSDART00000131564   None 78 None 3

The following transcripts of ENSDARG00000006235 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 12622489)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12605011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGGAGTCAGTGAAGAATAAATATGACTGTGAAACCCAAGCAGCGTTC[C/T]AGCACTGGGAGGTGAGATATACAGATTTAATCCACTATTACCGAAACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link