
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ddx39a
- Ensembl ID:
- ENSDARG00000006225
- ZFIN ID:
- ZDB-GENE-030131-4275
- Description:
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 39a [Source:RefSeq peptide;Acc:NP_956015]
- Human Orthologue:
- DDX39
- Human Description:
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 [Source:HGNC Symbol;Acc:17821]
- Mouse Orthologue:
- Ddx39
- Mouse Description:
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI Symbol;Acc:MGI:1915528]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19553 | Nonsense | Available for shipment | Available now |
sa38287 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa19553
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014727 | Nonsense | 26 | 427 | 2 | 10 |
ENSDART00000101224 | None | 346 | 2 | 11 | |
ENSDART00000145757 | Nonsense | 26 | 244 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 45668691)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 44511910 GRCz11 1 45213213 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTGTTGGACTATGAGGAAGATGAGGAGCCACAGCCCACTGTAGACAGC[G/T]GAGCCACCACTGGCAAGAAGGAGGTTAAAGGGTCTTACGTGTCCATCCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38287
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014727 | Nonsense | 328 | 427 | 8 | 10 |
ENSDART00000101224 | Nonsense | 247 | 346 | 9 | 11 |
ENSDART00000145757 | None | 244 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 45663921)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 44507140 GRCz11 1 45208443 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGGTTGGCCGAGAAATGCAAATTCTCCTTCTCTGTCTTGCAGGTTATCT[C/T]GATATCAGCAGTTTAAAGACTTTCAGCGGCGGATTCTGGTGGCTACGAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: