ddx39a

Ensembl ID:
ENSDARG00000006225
ZFIN ID:
ZDB-GENE-030131-4275
Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39a [Source:RefSeq peptide;Acc:NP_956015]
Human Orthologue:
DDX39
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 [Source:HGNC Symbol;Acc:17821]
Mouse Orthologue:
Ddx39
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI Symbol;Acc:MGI:1915528]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19553 Nonsense Available for shipment Available now
sa38287 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014727 Nonsense 26 427 2 10
ENSDART00000101224   None 346 2 11
ENSDART00000145757 Nonsense 26 244 2 5
Genomic Location (Zv9):
Chromosome 1 (position 45668691)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44511910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGTTGGACTATGAGGAAGATGAGGAGCCACAGCCCACTGTAGACAGC[G/T]GAGCCACCACTGGCAAGAAGGAGGTTAAAGGGTCTTACGTGTCCATCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014727 Nonsense 328 427 8 10
ENSDART00000101224 Nonsense 247 346 9 11
ENSDART00000145757   None 244 None 5
Genomic Location (Zv9):
Chromosome 1 (position 45663921)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44507140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTTGGCCGAGAAATGCAAATTCTCCTTCTCTGTCTTGCAGGTTATCT[C/T]GATATCAGCAGTTTAAAGACTTTCAGCGGCGGATTCTGGTGGCTACGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link