ugt1a5

Ensembl ID:
ENSDARG00000006220
ZFIN IDs:
ZDB-GENE-040426-2762, ZDB-GENE-071004-4, ZDB-GENE-071004-5, ZDB-GENE-080227-3, ZDB-GENE-080227-5, ZDB-GENE-080227-5, ZDB-GENE-080227-6, ZDB-GENE-080227-7, ZDB-GENE-080227-7
Description:
UDP glycosyltransferase 1 family, polypeptide A1 precursor [Source:RefSeq peptide;Acc:NP_001032505]
Human Orthologues:
UGT1A1, UGT1A10, UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7, UGT1A8, UGT1A9
Human Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 [Source:HGNC Symbol;Acc:12530]
UDP glucuronosyltransferase 1 family, polypeptide A10 [Source:HGNC Symbol;Acc:12531]
UDP glucuronosyltransferase 1 family, polypeptide A3 [Source:HGNC Symbol;Acc:12535]
UDP glucuronosyltransferase 1 family, polypeptide A4 [Source:HGNC Symbol;Acc:12536]
UDP glucuronosyltransferase 1 family, polypeptide A5 [Source:HGNC Symbol;Acc:12537]
UDP glucuronosyltransferase 1 family, polypeptide A6 [Source:HGNC Symbol;Acc:12538]
UDP glucuronosyltransferase 1 family, polypeptide A7 [Source:HGNC Symbol;Acc:12539]
UDP glucuronosyltransferase 1 family, polypeptide A8 [Source:HGNC Symbol;Acc:12540]
UDP glucuronosyltransferase 1 family, polypeptide A9 [Source:HGNC Symbol;Acc:12541]
Mouse Orthologues:
Ugt1a1, Ugt1a10, Ugt1a2, Ugt1a5, Ugt1a6a, Ugt1a6b, Ugt1a7c, Ugt1a8, Ugt1a9
Mouse Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 Gene [Source:MGI Symbol;Acc:MGI:98898]
UDP glucuronosyltransferase 1 family, polypeptide A2 Gene [Source:MGI Symbol;Acc:MGI:3576049]
UDP glucuronosyltransferase 1 family, polypeptide A5 Gene [Source:MGI Symbol;Acc:MGI:3032634]
UDP glucuronosyltransferase 1 family, polypeptide A6A Gene [Source:MGI Symbol;Acc:MGI:2137698]
UDP glucuronosyltransferase 1 family, polypeptide A6B Gene [Source:MGI Symbol;Acc:MGI:3580629]
UDP glucuronosyltransferase 1 family, polypeptide A7C Gene [Source:MGI Symbol;Acc:MGI:3032636]
UDP glucuronosyltransferase 1 family, polypeptide A8 Gene [Source:MGI Symbol;Acc:MGI:3576090]
UDP glucuronosyltransferase 1 family, polypeptide A9 Gene [Source:MGI Symbol;Acc:MGI:3576092]
UDP glycosyltransferase 1 family, polypeptide A10 Gene [Source:MGI Symbol;Acc:MGI:3580642]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8443 Nonsense Mutation detected in F1 DNA During 2014
sa8617 Nonsense Mutation detected in F1 DNA During 2014
sa18078 Nonsense Available for shipment Available now
sa15206 Nonsense Available for shipment Available now
sa5524 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243 None None 520 None 5
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243 None None 520 None 5
Genomic Location:
Chromosome 9 (position 10228430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCMCTAGTTTTGTGTCTTTTCTGCCTAGTATCAGCAGAAGCTGGGAAYT[T/G]ACTRGTAATTCCAGCRCTTGGCAGCCACTGGACTGGCATGAGACCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243 None None 520 None 5
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243 None None 520 None 5
Genomic Location:
Chromosome 9 (position 10228430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCMCTAGTTTTGTGTCTTTTCTGCCTAGTATCAGCAGAAGCTGGGAAYT[T/G]ACTRGTAATTCCAGCRCTTGGCAGCCACTGGACTGGCATGAGACCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 Nonsense 94 520 1 5
ENSDART00000124516 None None 520 None 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 None None 527 None 5
ENSDART00000130243 None None 520 None 5
Genomic Location:
Chromosome 9 (position 10222586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATAMAGGAGATTGTGMAAGCCGGTGTTACAACTCTGATAAGTACTTA[T/A]GTATCTACAGATCTGSCYAGGTTTCAGAGTTTCATCAACAGAATGAATTY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 None None 520 None 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 None None 527 None 5
ENSDART00000130243 Nonsense 5 520 1 5
Genomic Location:
Chromosome 9 (position 10205470)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCTCCTGCCACTGTACTTCACATCATTGAYAAATGGCTTGCTTGTG[G/A]TTGCTCGGGAGTCTGCTCCTCCTTGGTTCAGCTGAAGCTGGGAAACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 None None 520 None 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 None None 527 None 5
ENSDART00000130243 Nonsense 196 520 1 5
Genomic Location:
Chromosome 9 (position 10204899)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCAGCTCCACCATCTTATGTTCCACAAACATTTACTCATTTTACTGAC[C/T]GMATGAATCTCTGGCAAAGAAGTATAAACTTTGTAAGGGCTCTTCTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lez8ni1s