ugt1a5

Ensembl ID:
ENSDARG00000006220
ZFIN IDs:
ZDB-GENE-040426-2762, ZDB-GENE-071004-4, ZDB-GENE-071004-5, ZDB-GENE-080227-3, ZDB-GENE-080227-5, ZDB-GENE-080227-5, ZDB-GENE-080227-6, ZDB-GENE-080227-7, ZDB-GENE-080227-7
Description:
UDP glycosyltransferase 1 family, polypeptide A1 precursor [Source:RefSeq peptide;Acc:NP_001032505]
Human Orthologues:
UGT1A1, UGT1A10, UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7, UGT1A8, UGT1A9
Human Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 [Source:HGNC Symbol;Acc:12530]
UDP glucuronosyltransferase 1 family, polypeptide A10 [Source:HGNC Symbol;Acc:12531]
UDP glucuronosyltransferase 1 family, polypeptide A3 [Source:HGNC Symbol;Acc:12535]
UDP glucuronosyltransferase 1 family, polypeptide A4 [Source:HGNC Symbol;Acc:12536]
UDP glucuronosyltransferase 1 family, polypeptide A5 [Source:HGNC Symbol;Acc:12537]
UDP glucuronosyltransferase 1 family, polypeptide A6 [Source:HGNC Symbol;Acc:12538]
UDP glucuronosyltransferase 1 family, polypeptide A7 [Source:HGNC Symbol;Acc:12539]
UDP glucuronosyltransferase 1 family, polypeptide A8 [Source:HGNC Symbol;Acc:12540]
UDP glucuronosyltransferase 1 family, polypeptide A9 [Source:HGNC Symbol;Acc:12541]
Mouse Orthologues:
Ugt1a1, Ugt1a10, Ugt1a2, Ugt1a5, Ugt1a6a, Ugt1a6b, Ugt1a7c, Ugt1a8, Ugt1a9
Mouse Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 Gene [Source:MGI Symbol;Acc:MGI:98898]
UDP glucuronosyltransferase 1 family, polypeptide A2 Gene [Source:MGI Symbol;Acc:MGI:3576049]
UDP glucuronosyltransferase 1 family, polypeptide A5 Gene [Source:MGI Symbol;Acc:MGI:3032634]
UDP glucuronosyltransferase 1 family, polypeptide A6A Gene [Source:MGI Symbol;Acc:MGI:2137698]
UDP glucuronosyltransferase 1 family, polypeptide A6B Gene [Source:MGI Symbol;Acc:MGI:3580629]
UDP glucuronosyltransferase 1 family, polypeptide A7C Gene [Source:MGI Symbol;Acc:MGI:3032636]
UDP glucuronosyltransferase 1 family, polypeptide A8 Gene [Source:MGI Symbol;Acc:MGI:3576090]
UDP glucuronosyltransferase 1 family, polypeptide A9 Gene [Source:MGI Symbol;Acc:MGI:3576092]
UDP glycosyltransferase 1 family, polypeptide A10 Gene [Source:MGI Symbol;Acc:MGI:3580642]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8443 Nonsense Mutation detected in F1 DNA During 2016
sa8617 Nonsense Mutation detected in F1 DNA During 2016
sa18078 Nonsense Available for shipment Available now
sa34568 Nonsense Mutation detected in F1 DNA During 2016
sa15206 Nonsense Available for shipment Available now
sa27349 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246   None 525 None 5
ENSDART00000014518   None 526 None 5
ENSDART00000081463   None 520 None 5
ENSDART00000102448   None 342 None 6
ENSDART00000121990   None 519 None 5
ENSDART00000123415   None 515 None 5
ENSDART00000124423   None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852   None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243   None 520 None 5
ENSDART00000010246   None 525 None 5
ENSDART00000014518   None 526 None 5
ENSDART00000081463   None 520 None 5
ENSDART00000102448   None 342 None 6
ENSDART00000121990   None 519 None 5
ENSDART00000123415   None 515 None 5
ENSDART00000124423   None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852   None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243   None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10228430)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10032277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCMCTAGTTTTGTGTCTTTTCTGCCTAGTATCAGCAGAAGCTGGGAAYT[T/G]ACTRGTAATTCCAGCRCTTGGCAGCCACTGGACTGGCATGAGACCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246   None 525 None 5
ENSDART00000014518   None 526 None 5
ENSDART00000081463   None 520 None 5
ENSDART00000102448   None 342 None 6
ENSDART00000121990   None 519 None 5
ENSDART00000123415   None 515 None 5
ENSDART00000124423   None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852   None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243   None 520 None 5
ENSDART00000010246   None 525 None 5
ENSDART00000014518   None 526 None 5
ENSDART00000081463   None 520 None 5
ENSDART00000102448   None 342 None 6
ENSDART00000121990   None 519 None 5
ENSDART00000123415   None 515 None 5
ENSDART00000124423   None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852   None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243   None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10228430)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10032277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCMCTAGTTTTGTGTCTTTTCTGCCTAGTATCAGCAGAAGCTGGGAAYT[T/G]ACTRGTAATTCCAGCRCTTGGCAGCCACTGGACTGGCATGAGACCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246   None 525 None 5
ENSDART00000014518   None 526 None 5
ENSDART00000081463   None 520 None 5
ENSDART00000102448   None 342 None 6
ENSDART00000121990   None 519 None 5
ENSDART00000123415   None 515 None 5
ENSDART00000124423 Nonsense 94 520 1 5
ENSDART00000124516   None 520 None 5
ENSDART00000125852   None 536 None 5
ENSDART00000127780   None 527 None 5
ENSDART00000130243   None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10222586)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10026433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATAMAGGAGATTGTGMAAGCCGGTGTTACAACTCTGATAAGTACTTA[T/A]GTATCTACAGATCTGSCYAGGTTTCAGAGTTTCATCAACAGAATGAATTY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246   None 525 None 5
ENSDART00000014518 Nonsense 255 526 1 5
ENSDART00000081463   None 520 None 5
ENSDART00000102448   None 342 None 6
ENSDART00000121990   None 519 None 5
ENSDART00000123415   None 515 None 5
ENSDART00000124423   None 520 None 5
ENSDART00000124516   None 520 None 5
ENSDART00000125852 Nonsense 265 536 1 5
ENSDART00000127780   None 527 None 5
ENSDART00000130243   None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10206685)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10010532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGACACCTCATACGCAGAGCTGTTAGGTCACGGTGCAGTTTGGCTTT[T/A]AAGGTACGACTTCAGCTTTGAATACCCTAAACCCCAAATGCCAAACATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246   None 525 None 5
ENSDART00000014518   None 526 None 5
ENSDART00000081463   None 520 None 5
ENSDART00000102448   None 342 None 6
ENSDART00000121990   None 519 None 5
ENSDART00000123415   None 515 None 5
ENSDART00000124423   None 520 None 5
ENSDART00000124516   None 520 None 5
ENSDART00000125852   None 536 None 5
ENSDART00000127780   None 527 None 5
ENSDART00000130243 Nonsense 5 520 1 5
Genomic Location (Zv9):
Chromosome 9 (position 10205470)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10009317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCTCCTGCCACTGTACTTCACATCATTGAYAAATGGCTTGCTTGTG[G/A]TTGCTCGGGAGTCTGCTCCTCCTTGGTTCAGCTGAAGCTGGGAAACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 Nonsense 16 525 1 5
ENSDART00000014518   None 526 None 5
ENSDART00000081463   None 520 None 5
ENSDART00000102448   None 342 None 6
ENSDART00000121990   None 519 None 5
ENSDART00000123415   None 515 None 5
ENSDART00000124423   None 520 None 5
ENSDART00000124516   None 520 None 5
ENSDART00000125852   None 536 None 5
ENSDART00000127780   None 527 None 5
ENSDART00000130243   None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10202534)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10006381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATGAGAACACTGCCTGTTCCTGCTCAGGGGCTTCTCGCCTTGCTGTG[C/A]TTGTTCTCTTTTGAGTCTGTGCAAGCTGGAAAGGTGCTTGTCTTACCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link