gnl3

Ensembl ID:
ENSDARG00000006219
ZFIN ID:
ZDB-GENE-030131-616
Description:
Guanine nucleotide-binding protein-like 3 [Source:UniProtKB/Swiss-Prot;Acc:Q6DRP2]
Human Orthologue:
GNL3
Human Description:
guanine nucleotide binding protein-like 3 (nucleolar) [Source:HGNC Symbol;Acc:29931]
Mouse Orthologue:
Gnl3
Mouse Description:
guanine nucleotide binding protein-like 3 (nucleolar) Gene [Source:MGI Symbol;Acc:MGI:1353651]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41766 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122953 Nonsense 416 561 12 15

The following transcripts of ENSDARG00000006219 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 4029698)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3948202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTGATGTTTTTAGGGCTAAGCTGAGTTACTACAGCAGAGTTCCAGAG[C/T]GACAGGGTCTTCCCTCTTACCTGTCCGACGCCATCGTGACTGAACTGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link