MYT1L (2 of 2)

Ensembl ID:
ENSDARG00000006212
Description:
myelin transcription factor 1-like [Source:HGNC Symbol;Acc:7623]
Human Orthologue:
MYT1L
Human Description:
myelin transcription factor 1-like [Source:HGNC Symbol;Acc:7623]
Mouse Orthologue:
Myt1l
Mouse Description:
myelin transcription factor 1-like Gene [Source:MGI Symbol;Acc:MGI:1100511]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1325 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047089 Essential Splice Site 49 721 1 29
Genomic Location:
Chromosome 17 (position 51997429)
KASP Assay ID:
554-1239.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCGCAGCCTGTCTGGATGTCCTCATAAAGAYAGAGTCCCRCCRGAAA[G/T]TAAGCCCTCGACACCGTCCCCGCAAACACCACATGAGCTGCTGCTGCCTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ames6vyd