erbb3a

Ensembl ID:
ENSDARG00000006202
ZFIN ID:
ZDB-GENE-030916-3
Description:
erbB-3a [Source:RefSeq peptide;Acc:NP_001005320]
Human Orthologue:
ERBB3
Human Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) [Source:HGNC Symbol;Acc:3431]
Mouse Orthologue:
Erbb3
Mouse Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene [Source:MGI Symbol;Acc:MGI:95

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7024 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014892 Nonsense 118 1305 2 26
Genomic Location:
Chromosome 6 (position 7407954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACGTCTCTGTATGAAGATAAATTCGCCCTCGCTGTCCTTGTCAACTA[T/A]CAGAAAGACGGAGTGTATGGACTGAGGGAGCTGGGCCTCACACACTTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/94afs2pa