sav1

Ensembl ID:
ENSDARG00000006196
ZFIN ID:
ZDB-GENE-040912-28
Description:
protein salvador homolog 1 [Source:RefSeq peptide;Acc:NP_001004560]
Human Orthologue:
SAV1
Human Description:
salvador homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17795]
Mouse Orthologue:
Sav1
Mouse Description:
salvador homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1927144]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31951 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012357 Nonsense 147 397 2 5
ENSDART00000121782 Nonsense 147 412 2 6
Genomic Location (Zv9):
Chromosome 13 (position 37197311)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36669613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCCCGTATTACTATCCTCCAGAACCATACTACAATAACCAACCCAGA[C/T]GAGCACGCAGACCAGACCACTTTAATGAGAACTACAGATACTATGACCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link