gatad2a

Ensembl ID:
ENSDARG00000006192
ZFIN ID:
ZDB-GENE-040426-2372
Description:
p66 alpha [Source:RefSeq peptide;Acc:NP_998081]
Human Orthologue:
GATAD2A
Human Description:
GATA zinc finger domain containing 2A [Source:HGNC Symbol;Acc:29989]
Mouse Orthologue:
Gatad2a
Mouse Description:
GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43810 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033103 Nonsense 331 632 8 11
ENSDART00000105424   None 278 8 11
ENSDART00000137985   None 278 None 4
Genomic Location (Zv9):
Chromosome 22 (position 18597961)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18348896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACTCTCCTGCTAGCCGACAGGCGGCTGCTAAGCTTGCTTTACGGAAA[C/T]AGCTGGAGAAAACCCTGCTTGAGATCCCACCTCCTAAACCTCCAGCGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link