hif1aa

Ensembl ID:
ENSDARG00000006181
ZFIN ID:
ZDB-GENE-080917-55
Human Orthologue:
HIF1A
Human Description:
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) [Source:HGNC
Mouse Orthologue:
Hif1a
Mouse Description:
hypoxia inducible factor 1, alpha subunit Gene [Source:MGI Symbol;Acc:MGI:106918]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6314 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16875 Nonsense Available for shipment Available now
sa13792 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044282 Essential Splice Site 75 760 None 16
ENSDART00000144328 Essential Splice Site 61 189 None 10
ENSDART00000147222 Essential Splice Site 65 708 None 14
Genomic Location:
Chromosome 13 (position 31993605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGACTGGCTCTCAGTTACCTGCGCCTGCGTAAACTGCTGAACAGCGG[T/A]GAGAGAGGATGAATGTGYGGTGAGATCATGAACTCTCMTGTGTTTGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044282 Nonsense 278 760 7 16
ENSDART00000144328 None None 189 7 10
ENSDART00000147222 Nonsense 267 708 6 14
Genomic Location:
Chromosome 13 (position 31998291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGTTTTGATCCAGWGGATGTGTTACAGCATTCWGTGTATGAATACTA[T/A]CATGCGTTGGATTCAGACCACATGACCAAAACACACCACAGCCGTAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044282 Nonsense 683 760 15 16
ENSDART00000144328 None None 189 None 10
ENSDART00000147222 Nonsense 631 708 13 14
Genomic Location:
Chromosome 13 (position 32006864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTTTCTCCCAGGGGTCTGTGCTGCAGGTTGTTACCGATTTTCCAGAG[A/T]AAAAGGTCCGCAAAACAGATGCTCCATCATCAGAAGGAATTCGTCATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5tsaeyr3