LRRK2

Ensembl ID:
ENSDARG00000006169
Description:
leucine-rich repeat kinase 2 [Source:HGNC Symbol;Acc:18618]
Human Orthologue:
LRRK2
Human Description:
leucine-rich repeat kinase 2 [Source:HGNC Symbol;Acc:18618]
Mouse Orthologue:
Lrrk2
Mouse Description:
leucine-rich repeat kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1913975]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3318 Nonsense Mutation detected in F1 DNA During 2014
sa4314 Nonsense Mutation detected in F1 DNA During 2014
sa6814 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8399 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5114 Essential Splice Site F2 line generated During 2014
sa6813 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Nonsense 90 2538 4 57
Genomic Location:
Chromosome 25 (position 36750568)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCATCCTAGGTTGGCTGGTCTCTGCTGTGTCGGCTGATGGAAATCTG[T/A]CCCAACACTCTGGATAATCTGGCCAGACCGGTGGACTATGAATTTATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Nonsense 190 2538 7 57
Genomic Location:
Chromosome 25 (position 36748244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TARTGTCAGTTCTGCCCATTTGACCTGTGTGATTTNGTTAGTTTCTGAGTA[T/A]CACCTGGCGGAGTTCATCGAGAAGAAGGACCATGAGGTGGTTTTGAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 390 2538 12 57
Genomic Location:
Chromosome 25 (position 36745641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGCTTCTCCATTGCAACACAWCCAACMATGYGGAACTGGAAGGAAGG[T/G]TAGCGTTCCTTAATGTYRTGCGCTACATTACAGATTTGCATTCAGGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 1768 2538 42 57
Genomic Location:
Chromosome 25 (position 36714205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAACCCAGCTAGTTTCATCAAGATCACCGTTCCATGCTCTCGCAAAG[G/A]TAAAAGANNAACTTSTWTTGCAGTGTTTGGACYNNCTTAAACACTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5114
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 1882 2538 45 57
Genomic Location:
Chromosome 25 (position 36711224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACAAGCATGAAGGCAATGTGGATCGAAAGTAACNNTGTGTTTTTATAC[T/C]GAAGGGGATGGAGGTTTTGGCTCGGTTTATAAAGCTKTSTACAAGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Nonsense 2153 2538 50 57
Genomic Location:
Chromosome 25 (position 36707958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGATGTTGTGTCTGAYGCGAGAGCTGAATGTTGTGGGTTTTCCAGGC[G/T]AGTGTTTTGTCGTGTCCAATTCAGGCGGAGCTGCAAACGGAGGTAAAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Parkinson's disease: Comprehensive research synopsis and systematic meta-analyses in Parkinson's disease genetics: The PDGene database. (View Study)
  • Parkinson's disease: Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease. (View Study)
  • Parkinson's disease: Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies. (View Study)
  • Parkinson's disease: Web-based genome-wide association study identifies two novel loci and a substantial genetic component for Parkinson's disease. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/flxgp55o