pde11al

Ensembl ID:
ENSDARG00000006151
ZFIN ID:
ZDB-GENE-031118-106
Human Orthologue:
PDE11A
Human Description:
phosphodiesterase 11A [Source:HGNC Symbol;Acc:8773]
Mouse Orthologue:
Pde11a
Mouse Description:
phosphodiesterase 11A Gene [Source:MGI Symbol;Acc:MGI:3036251]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42705 Nonsense Mutation detected in F1 DNA During 2017
sa11083 Nonsense Available for shipment Available now
sa5892 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32085 Nonsense Available for shipment Available now
sa11067 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Nonsense 121 927 1 20
ENSDART00000133403   None 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23269847)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21379598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCCAGTCGAGCATGCGGCGGCGCGCGCTCCTGCGGAAAGCCAGTTCGT[T/A]ACCGCCGACCACCGCGCACATCTTGAGCGCGCTGCTCGAGTCCCGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Nonsense 142 927 1 20
ENSDART00000133403   None 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23269783)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21379534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCACATCTTGAGCGCGCTGCTCGAGTCCCGAGTGAACGTGCCTCAATA[T/A]GCCTCCAGCGCCATTGACTACAAATACCGACTYAAAGAGTCCAACGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Essential Splice Site 600 927 11 20
ENSDART00000133403   None 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23246861)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21356612
KASP Assay ID:
554-3833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGTTTTTRGAGCTTGGTGTYGTACAGAAATTCAAAATTGATTATGAG[G/A]TAAGGCAATCACCACATAAATGGAGGCCAAAATCCAACTCTGCTGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Nonsense 689 927 14 20
ENSDART00000133403   None 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23240631)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21350382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGTCTGGCTCAGCACTGGCACTGCTGTATGGAACATCTGCCACACTT[G/T]AGCATCATCATTTCAACCACGCTGTCATGATCCTGCAGAGTGAGGTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Essential Splice Site 813 927 None 20
ENSDART00000133403 Essential Splice Site 342 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23229843)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21339594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGAACAAGGTGACAGGGAGAGATCGGAGCTGAAGCTGACACCAGCTG[T/A]RTGTAATCTTTCATCATCARAAAATTATGATTATTAAACTTTGCTTTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link