si:ch211-227c6.4

Ensembl ID:
ENSDARG00000006128
ZFIN ID:
ZDB-GENE-090312-109
Description:
Novel protein similar to vertebrate centrosomal protein 170kDa (CEP170) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
CEP170
Human Description:
centrosomal protein 170kDa [Source:HGNC Symbol;Acc:28920]
Mouse Orthologue:
Cep170
Mouse Description:
centrosomal protein 170 Gene [Source:MGI Symbol;Acc:MGI:1918348]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22243 Essential Splice Site Available for shipment Available now
sa22242 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040704 Essential Splice Site 168 548 6 9
ENSDART00000108709 Essential Splice Site 168 388 6 13
ENSDART00000135989   None 697 None 8
Genomic Location (Zv9):
Chromosome 13 (position 10600444)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10902773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAGTCAAACCTGCGGAGCCTAACAAAGGAGACGACAAGATGCCAG[G/A]TAAAGAAACCGTATGATGATGTCAGGGTGTAAGATAATTATATTAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040704   None 548 None 9
ENSDART00000108709 Nonsense 348 388 12 13
ENSDART00000135989 Nonsense 661 697 8 8
Genomic Location (Zv9):
Chromosome 13 (position 10549337)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10851666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTGGATCTCAGAGCGGATGGGCACCTCTGCCCAGTAACGGAACCCCA[C/T]AACCACCACCACCAACAACCATAACCAACCCTAGCCCAGAAAAACCCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link