csnk1db

Ensembl ID:
ENSDARG00000006125
ZFIN ID:
ZDB-GENE-040426-2385
Description:
Casein kinase I isoform delta-B [Source:UniProtKB/Swiss-Prot;Acc:Q6P3K7]
Human Orthologue:
CSNK1D
Human Description:
casein kinase 1, delta [Source:HGNC Symbol;Acc:2452]
Mouse Orthologue:
Csnk1d
Mouse Description:
casein kinase 1, delta Gene [Source:MGI Symbol;Acc:MGI:1355272]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35337 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021491 Essential Splice Site 295 409 6 10
Genomic Location (Zv9):
Chromosome 12 (position 34824707)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33228816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGGCTTTTCCTATGACTACGTGTTTGATTGGAACATGCTCAAATTTG[T/C]AAGTACATGTTTGGATGATCTTCATACTTTAGAGTGTGATCATTTTGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link