kdm5c

Ensembl ID:
ENSDARG00000006124
ZFIN ID:
ZDB-GENE-060810-94
Description:
lysine-specific demethylase 5C [Source:RefSeq peptide;Acc:NP_001116706]
Human Orthologues:
KDM5C, KDM5D
Human Descriptions:
lysine (K)-specific demethylase 5C [Source:HGNC Symbol;Acc:11114]
lysine (K)-specific demethylase 5D [Source:HGNC Symbol;Acc:11115]
Mouse Orthologues:
Kdm5c, Kdm5d
Mouse Descriptions:
lysine (K)-specific demethylase 5C Gene [Source:MGI Symbol;Acc:MGI:99781]
lysine (K)-specific demethylase 5D Gene [Source:MGI Symbol;Acc:MGI:99780]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41261 Nonsense Mutation detected in F1 DNA During 2016
sa15146 Essential Splice Site Available for shipment Available now
sa17413 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098657 Nonsense 547 1578 12 27
ENSDART00000127053 Nonsense 547 1578 13 28
ENSDART00000131117   None 544 None 7

The following transcripts of ENSDARG00000006124 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 38117308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGGTGCCATGGCTATATGTGGGCATGGTGTTCTCTGCTTTCTGTTG[G/A]CACATAGAGGACCACTGGAGTTACTCCATCAATTATTTACACTGGTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098657 Essential Splice Site 824 1578 17 27
ENSDART00000127053 Essential Splice Site 824 1578 18 28
ENSDART00000131117   None 544 None 7

The following transcripts of ENSDARG00000006124 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 38122861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCYAACCGCGTGAAGGAAGCCCTAGAGCAGGATGAAGGCAACAAAATAGG[T/G]AACTGTATTTMTTTACATYAGTGGTTCTCAACCMCATTCCTGAAGCCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098657 Nonsense 1374 1578 23 27
ENSDART00000127053 Nonsense 1374 1578 24 28
ENSDART00000131117 Nonsense 488 544 6 7

The following transcripts of ENSDARG00000006124 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 38129143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGGCATTAGACACTCCAGAAGTACAGGAGGYGCTAGACAGACTGCAA[C/T]AAGTAGAGGATGAMATGGTCAGTATAAAAGAGGAAGAACCAGAGGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link