tbx2b

Ensembl ID:
ENSDARG00000006120
ZFIN ID:
ZDB-GENE-990726-27
Description:
T-box transcription factor TBX2b [Source:UniProtKB/Swiss-Prot;Acc:Q7ZTU9]
Human Orthologue:
TBX2
Human Description:
T-box 2 [Source:HGNC Symbol;Acc:11597]
Mouse Orthologue:
Tbx2
Mouse Description:
T-box 2 Gene [Source:MGI Symbol;Acc:MGI:98494]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7761 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005491 Nonsense 129 671 2 8
ENSDART00000122101 Nonsense 139 687 2 7
Genomic Location:
Chromosome 15 (position 26714926)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGTTWCCACCTTTTAAGGTCCGCATTAATGGAYTCGATAAAAAAGCC[A/T]AGTATATTCTTTTAATGGACATTGTGGCTGCCGACGACTGCCGCTACAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gzl83dz2