igf2r

Ensembl ID:
ENSDARG00000006094
ZFIN ID:
ZDB-GENE-041014-300
Description:
cation-independent mannose-6-phosphate receptor [Source:RefSeq peptide;Acc:NP_001034716]
Human Orthologue:
IGF2R
Human Description:
insulin-like growth factor 2 receptor [Source:HGNC Symbol;Acc:5467]
Mouse Orthologue:
Igf2r
Mouse Description:
insulin-like growth factor 2 receptor Gene [Source:MGI Symbol;Acc:MGI:96435]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23790 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23791 Nonsense Mutation detected in F1 DNA During 2014
sa23792 Nonsense Mutation detected in F1 DNA During 2014
sa14455 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061101 Essential Splice Site 394 2459 9 47
Genomic Location:
Chromosome 20 (position 42621892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCGATGTAAAGAAGATTGCTGGAAGATACCAGAACCAAACCCTGAGG[T/C]TCACTTCATGTGATTCTGATATGCATAAACCTTAAATGTGGCTCAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061101 Nonsense 751 2459 16 47
Genomic Location:
Chromosome 20 (position 42634201)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGGATGAGTACACGTATAACTTTAAGTGGTACACTTCCTACGCCTG[T/A]CCAGAGAGATTACATGAGTGTGTCGTGACAGACCCCGAAACTCTTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061101 Nonsense 1100 2459 23 47
Genomic Location:
Chromosome 20 (position 42645127)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGAGAAGTCATATGTTCCTCTGGACACCTCGGATCAGGCCCGGTTT[C/T]AGAAGTTTTACGTAAATGTGTGTAAACCACTGCCTCGTGTTCAGGGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061101 Nonsense 1219 2459 26 47
Genomic Location:
Chromosome 20 (position 42648823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCTGTCACAGGTGAAAACTKCAAAGTCACAGACCCCAAGAGCGGTTA[T/A]GAGTACAATCTCACACCGTTGGCTGGAMARGACTATGAAGTGAAGAGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hoefq87m