LOC567161

Ensembl ID:
ENSDARG00000006079
Human Orthologue:
GPR37L1
Human Description:
G protein-coupled receptor 37 like 1 [Source:HGNC Symbol;Acc:14923]
Mouse Orthologue:
Gpr37l1
Mouse Description:
G protein-coupled receptor 37-like 1 Gene [Source:MGI Symbol;Acc:MGI:1928503]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009756 Nonsense 43 388 1 3
Genomic Location:
Chromosome 22 (position 656465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCRCTGATCGTGTTCTCCGTGGGCATCGTGGGAAACCTRGCGCTYATGTG[T/A]ATCGTGTGGCACAACTATTACCTGAAGAGYACCTGGAACTGCGTGCTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x6lhzltn