akap1b

Ensembl ID:
ENSDARG00000006062
ZFIN ID:
ZDB-GENE-030131-6844
Description:
A kinase anchor protein 1, mitochondrial [Source:RefSeq peptide;Acc:NP_001091649]
Human Orthologue:
AKAP1
Human Description:
A kinase (PRKA) anchor protein 1 [Source:HGNC Symbol;Acc:367]
Mouse Orthologue:
Akap1
Mouse Description:
A kinase (PRKA) anchor protein 1 Gene [Source:MGI Symbol;Acc:MGI:104729]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2831 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025713 None None 837 None 10
ENSDART00000112511 Essential Splice Site None 760 1 12
ENSDART00000138988 Essential Splice Site None 837 1 11

The following transcripts of ENSDARG00000006062 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 30154748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTACATTTAACATTATACGGTGGCGGTGYGAGGGACGCATAAACACA[G/T]TGAGTATGACCCGTGTGCGCGCGTTTTACCTCATGTGTAGATAGGTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qap7h1fv