akap1b

Ensembl ID:
ENSDARG00000006062
ZFIN ID:
ZDB-GENE-030131-6844
Description:
A kinase anchor protein 1, mitochondrial [Source:RefSeq peptide;Acc:NP_001091649]
Human Orthologue:
AKAP1
Human Description:
A kinase (PRKA) anchor protein 1 [Source:HGNC Symbol;Acc:367]
Mouse Orthologue:
Akap1
Mouse Description:
A kinase (PRKA) anchor protein 1 Gene [Source:MGI Symbol;Acc:MGI:104729]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2831 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32042 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025713   None 837 None 10
ENSDART00000112511 Essential Splice Site None 760 1 12
ENSDART00000138988 Essential Splice Site None 837 1 11

The following transcripts of ENSDARG00000006062 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 30154748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTACATTTAACATTATACGGTGGCGGTGYGAGGGACGCATAAACACA[G/T]TGAGTATGACCCGTGTGCGCGCGTTTTACCTCATGTGTAGATAGGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025713 Nonsense 828 837 10 10
ENSDART00000112511 Nonsense 751 760 12 12
ENSDART00000138988 Nonsense 828 837 11 11

The following transcripts of ENSDARG00000006062 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 30138367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCATTCCTTCTTTTGCAGCTGGTCCTGCTCAATCGCACTTTGGCAGAG[C/T]GAGGTTTCGGCACCTGGGTGGACAGTTTCTGATCCTCCAGAGCTCCTCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link