akap1b

Ensembl ID:
ENSDARG00000006062
ZFIN ID:
ZDB-GENE-030131-6844
Description:
A kinase anchor protein 1, mitochondrial [Source:RefSeq peptide;Acc:NP_001091649]
Human Orthologue:
AKAP1
Human Description:
A kinase (PRKA) anchor protein 1 [Source:HGNC Symbol;Acc:367]
Mouse Orthologue:
Akap1
Mouse Description:
A kinase (PRKA) anchor protein 1 Gene [Source:MGI Symbol;Acc:MGI:104729]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32042 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025713 Nonsense 828 837 10 10
ENSDART00000112511 Nonsense 751 760 12 12
ENSDART00000138988 Nonsense 828 837 11 11

The following transcripts of ENSDARG00000006062 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30138367)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30960074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCATTCCTTCTTTTGCAGCTGGTCCTGCTCAATCGCACTTTGGCAGAG[C/T]GAGGTTTCGGCACCTGGGTGGACAGTTTCTGATCCTCCAGAGCTCCTCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link