malt1

Ensembl ID:
ENSDARG00000006052
ZFIN ID:
ZDB-GENE-020801-2
Description:
mucosa associated lymphoid tissue lymphoma translocation gene 1 [Source:RefSeq peptide;Acc:NP_69450
Human Orthologue:
MALT1
Human Description:
mucosa associated lymphoid tissue lymphoma translocation gene 1 [Source:HGNC Symbol;Acc:6819]
Mouse Orthologue:
Malt1
Mouse Description:
mucosa associated lymphoid tissue lymphoma translocation gene 1 Gene [Source:MGI Symbol;Acc:MGI:2445

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4994 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008424 Nonsense 285 806 7 17
ENSDART00000147895 None None 108 7 15
Genomic Location:
Chromosome 22 (position 15858184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTTATGCCTGCAGAGTTTACAAYCTTTATCACGAAATGTGGAGTGAT[C/T]AGGTCCAAGTAAACATTGGTACGGCTCTTTGAGACTAAATTAATCTATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/53dnywao