ust

Ensembl ID:
ENSDARG00000006044
ZFIN ID:
ZDB-GENE-041001-163
Description:
uronyl 2-sulfotransferase [Source:RefSeq peptide;Acc:NP_001027901]
Human Orthologue:
UST
Human Description:
uronyl-2-sulfotransferase [Source:HGNC Symbol;Acc:17223]
Mouse Orthologue:
Ust
Mouse Description:
uronyl-2-sulfotransferase Gene [Source:MGI Symbol;Acc:MGI:2442406]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13830 Essential Splice Site Available for shipment Available now
sa4914 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007735 Essential Splice Site 220 407 5 8
ENSDART00000133808 Essential Splice Site 145 332 4 7
Genomic Location:
Chromosome 20 (position 31352476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCACCTGATCCGCACACCCCAGATGAAGGATGATGAGAGATATCTGG[T/C]CAGAAGCAYTTTCTGAAWCCCTTCCTTGCTTCCTCATTTTTTNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007735 Essential Splice Site 253 407 6 8
ENSDART00000133808 Essential Splice Site 178 332 5 7
Genomic Location:
Chromosome 20 (position 31339293)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTTCTACATCGTTCCATACTTTTGTGGACAACACCCTCAGTGCAGG[T/C]AATGCAATCTAAAAGCAAACTCTTCTTGTAGTGACAGTCRCAGAACCCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9ryoyud7