aebp2

Ensembl ID:
ENSDARG00000006038
ZFIN ID:
ZDB-GENE-040426-2885
Description:
Zinc finger protein AEBP2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXV2]
Human Orthologue:
AEBP2
Human Description:
AE binding protein 2 [Source:HGNC Symbol;Acc:24051]
Mouse Orthologue:
Aebp2
Mouse Description:
AE binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1338038]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14933 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019518 Nonsense 397 415 7 8
ENSDART00000128934 Nonsense 397 412 7 8
Genomic Location:
Chromosome 4 (position 2799955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGAGAGTGACCGTCCTCAGCTRAAGACCAAAGTKGTCCACCTTTCA[C/T]AGCTTCCTCAGGACACAGCGTTTCTGCTGGACCCAAAYATTTACAGGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d09keo6b