agtpbp1

Ensembl ID:
ENSDARG00000006021
ZFIN ID:
ZDB-GENE-081104-267
Description:
Cytosolic carboxypeptidase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q4U2V3]
Human Orthologue:
AGTPBP1
Human Description:
ATP/GTP binding protein 1 [Source:HGNC Symbol;Acc:17258]
Mouse Orthologue:
Agtpbp1
Mouse Description:
ATP/GTP binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2159437]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17482 Nonsense Available for shipment Available now
sa8921 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2426 Nonsense Available for shipment Available now
sa8379 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026050 Nonsense 115 1153 6 26
ENSDART00000134147 None None 722 None 13
Genomic Location:
Chromosome 8 (position 52180162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCAGGACTGGCTTGTTCGTGTCTAAAGGAGGAMCAGCCATTYTGCTG[C/T]AGCTGCTRGTGAGCTCCAGCAAAGACCCTCCGGCCAACGAGGAACTRATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026050 Essential Splice Site 434 1153 13 26
ENSDART00000134147 None None 722 None 13
Genomic Location:
Chromosome 8 (position 52170780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARCTCCGAGTCTACGAGCATTTCTGTCGGGAATTCACTGAAACTTTTCAG[G/A]TGAGGACTCTTCTGATTCACAATGTGAAATGAAACTAAGAATTTGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026050 Nonsense 486 1153 14 26
ENSDART00000134147 Nonsense 55 722 1 13
Genomic Location:
Chromosome 8 (position 52169662)
KASP Assay ID:
554-2807.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAAACAGACGTCCGCTCCGGGAAARCGCCCTGCCCCTAAAGCCTGAA[C/T]AATCTCCTCTGGAGCTGGACAGCATCTCCATAGCCAAGAGGCCGGACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026050 Essential Splice Site 734 1153 18 26
ENSDART00000134147 Essential Splice Site 303 722 5 13
Genomic Location:
Chromosome 8 (position 52163593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGCAGCCCTCATTGGGTTAGAACTGGATCAGACATCWGCTATTACAA[G/A]TAAAGAGCAAGTSGYACAGTGATTTATGGGTTGGTKTNNGCKMTGAAAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e8hjn888