kat2a

Ensembl ID:
ENSDARG00000006017
ZFIN ID:
ZDB-GENE-080403-11
Description:
PCAF [Source:UniProtKB/TrEMBL;Acc:Q1L672]
Human Orthologue:
KAT2A
Human Description:
K(lysine) acetyltransferase 2A [Source:HGNC Symbol;Acc:4201]
Mouse Orthologue:
Kat2a
Mouse Description:
K(lysine) acetyltransferase 2A Gene [Source:MGI Symbol;Acc:MGI:1343101]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31316 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13154 Nonsense Available for shipment Available now
sa10939 Essential Splice Site Available for shipment Available now
sa19974 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19975 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028072 Essential Splice Site 73 800 1 18
Genomic Location (Zv9):
Chromosome 3 (position 17297933)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17504266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCGGGCGAAAAAGCTGGAGAAACTCGGAGTGTTTTCATCCTGCAAGG[T/C]AACCGAGAGCTCGCCTCATAACAATGGAGAGACAGAGAGAGAAACCGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028072 Nonsense 252 800 5 18
Genomic Location (Zv9):
Chromosome 3 (position 17307587)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17513920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCGGCAGAGGGCTCAGAAAGAGGACGCAGCGGCATACAAAGTCGATTA[T/A]ACTAGRTGCTTGTGTYRCTGTGTTCTATTCTRAATGCACGTTTGTAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028072 Essential Splice Site 254 800 5 18
Genomic Location (Zv9):
Chromosome 3 (position 17307593)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17513926
KASP Assay ID:
2259-3243.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGGCTCAGAAAGAGGACGCAGCGGCATACAAAGTCGATTATACTAG[G/A]TGCTTGTGTYRCTGTGTTCTATTCTRAATGCACGTTTGTAGGATGTGYAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028072 Essential Splice Site 549 800 11 18
Genomic Location (Zv9):
Chromosome 3 (position 17315834)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17522167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCACAGAGATTGTCTTTTGTGCTGTCACCTCCAATGAACAGGTCAAG[G/A]TAAGTAGATGGAGACTCTGTGAAAGGTAATTGACTGAACAAGAGGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028072 Splice Site, Nonsense 686 800 16 18
Genomic Location (Zv9):
Chromosome 3 (position 17321631)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17528338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTAGGCTGTGTGTGTCTATTACTCACTCTTAACTTTTCCTCTGCAGT[A/T]AAGAGCTGAAAGATCCAGATCTGCTCTACAACATGCTGAAGAATCTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link