dct

Ensembl ID:
ENSDARG00000006008
ZFIN ID:
ZDB-GENE-000508-1
Description:
L-dopachrome tautomerase isoform 2 [Source:RefSeq peptide;Acc:NP_571630]
Human Orthologue:
DCT
Human Description:
dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) [Source:HGNC Symbol;
Mouse Orthologue:
Dct
Mouse Description:
dopachrome tautomerase Gene [Source:MGI Symbol;Acc:MGI:102563]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21611 Essential Splice Site Available for shipment Available now
sa34785 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022044 Essential Splice Site 344 513 5 8
ENSDART00000125715 Essential Splice Site 344 404 5 7
ENSDART00000145138 Essential Splice Site 250 419 4 7
Genomic Location (Zv9):
Chromosome 9 (position 55330645)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53807388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACTTCGACAGTCCACCGTATTTCACCAACTCCACCTTCAGCTTCAG[G/A]TAGAGAGACAGCACACTTCACCTAAAAATAAACGCATTCCATCATGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022044 Nonsense 448 513 7 8
ENSDART00000125715   None 404 None 7
ENSDART00000145138 Nonsense 354 419 6 7
Genomic Location (Zv9):
Chromosome 9 (position 55333989)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53810732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCTGTGACCAATGAGGAGATTTACATCGCATCTGAACAGCTCGGATA[T/G]TCATACTCCATCGACCTCGAAGGTAAATAAACAAAAACACAGGCTACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link