nudcd3

Ensembl ID:
ENSDARG00000006005
ZFIN ID:
ZDB-GENE-040426-2255
Description:
nudC domain containing 3 [Source:RefSeq peptide;Acc:NP_998356]
Human Orthologue:
NUDCD3
Human Description:
NudC domain containing 3 [Source:HGNC Symbol;Acc:22208]
Mouse Orthologue:
Nudcd3
Mouse Description:
NudC domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2144158]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6185 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020817 Nonsense 275 344 5 6
Genomic Location (Zv9):
Chromosome 10 (position 46289930)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45221146
KASP Assay ID:
554-4877.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTGAAGGGTGAAGCTGAAATCGATGTTAACCAGATTAATCGAGAG[C/T]GATCTATGGCCACGGYGGATGAAGAGGAACATGCGGTGCTGGACCGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link