prc1b

Ensembl ID:
ENSDARG00000005993
ZFIN ID:
ZDB-GENE-040426-777
Description:
protein regulator of cytokinesis 1 [Source:RefSeq peptide;Acc:NP_956528]
Human Orthologue:
PRC1
Human Description:
protein regulator of cytokinesis 1 [Source:HGNC Symbol;Acc:9341]
Mouse Orthologue:
Prc1
Mouse Description:
protein regulator of cytokinesis 1 Gene [Source:MGI Symbol;Acc:MGI:1858961]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38641 Nonsense Mutation detected in F1 DNA During 2017
sa7602 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098824 Nonsense 169 605 5 14
ENSDART00000134941 Nonsense 170 606 5 14
ENSDART00000141926   None 86 None 4
Genomic Location (Zv9):
Chromosome 7 (position 51821231)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50091467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAACTTAGGGTTCAGTTTGATTTACAGTTTGTTTATCTTTCCAGGAA[C/T]GAAGACATAAAGAATTTGTCACGTTGAAGAAGCAGATAATACTTTGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098824 Missense 385 605 9 14
ENSDART00000134941 Missense 386 606 9 14
ENSDART00000141926   None 86 None 4
Genomic Location (Zv9):
Chromosome 7 (position 51819562)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50089798
KASP Assay ID:
554-4214.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AANAGGAAAGAGCCAAAGATCCATCCAGATTCACCAACAGAGGAGGAAACC[T/C]TCTAAAAGAGGAGAAACAAAGGGCTGATATTGTCAAAGGTCTMCCTAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link