rgl1

Ensembl ID:
ENSDARG00000005989
ZFIN ID:
ZDB-GENE-040426-1816
Description:
Ral guanine nucleotide dissociation stimulator-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6P112]
Human Orthologue:
RGL1
Human Description:
ral guanine nucleotide dissociation stimulator-like 1 [Source:HGNC Symbol;Acc:30281]
Mouse Orthologue:
Rgl1
Mouse Description:
ral guanine nucleotide dissociation stimulator,-like 1 Gene [Source:MGI Symbol;Acc:MGI:107484]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34367 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010604 Nonsense 717 804 17 19
ENSDART00000137133   None 207 None 5
ENSDART00000138881 Nonsense 717 804 17 18

The following transcripts of ENSDARG00000005989 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 19812445)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19257083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTCCATGCAGCTGACCAGTCAGGACAAAACTCCAGCGGTGATCTCT[C/T]GAGCCATGACCAAACACAACCTGGAGGGCGAGCAGGCGGCTGACTATGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link