atad5b

Ensembl ID:
ENSDARG00000005974
ZFIN ID:
ZDB-GENE-030131-338
Description:
ATPase family, AAA domain containing 5b [Source:RefSeq peptide;Acc:NP_001076298]
Human Orthologue:
ATAD5
Human Description:
ATPase family, AAA domain containing 5 [Source:HGNC Symbol;Acc:25752]
Mouse Orthologue:
Atad5
Mouse Description:
ATPase family, AAA domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2442925]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17344 Nonsense Available for shipment Available now
sa1125 Nonsense F2 line generated During 2014
sa15284 Nonsense Available for shipment Available now
sa16554 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 160 1060 1 14
ENSDART00000135710 Nonsense 163 1060 1 14
Genomic Location:
Chromosome 6 (position 19365000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCATTGATCATTTTGGATCTAATAAAGAGGGGTTGACCAGATTTTTA[C/T]AAACAGAGATAGATGATGGGGACCACTTGATAGATCAGCMAAAAATGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1125
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 240 1060 2 14
ENSDART00000135710 Nonsense 243 1060 2 14
Genomic Location:
Chromosome 6 (position 19364369)
KASP Assay ID:
554-1036.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTGAAAATAGCTGTGAGTTGCTGAAAGACATTCAAAAACTCAATTTG[C/T]AGTTTCCTGTCCAAAGGTTTTTCACCCTTCTTCTGAAGAAGGGAACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 328 1060 3 14
ENSDART00000135710 Nonsense 331 1060 3 14
Genomic Location:
Chromosome 6 (position 19363990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGCTATTTTCTGATGTTTTGGTCAACCCTCATTCAAAGTACACAAAC[C/T]GACTGAGTCGAACAAAGTGCAGACAGCAAYAAACTACATTCTGTGYTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 338 1060 3 14
ENSDART00000135710 Nonsense 341 1060 3 14
Genomic Location:
Chromosome 6 (position 19363960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATTCAAAGTACACAAACYGACTGAGTCGAACAAAGTGCAGACAGCAA[C/T]AAACTACATTCTGTGYTATAGTCACTGAACCAGTACAAAATGACTCTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uykqoxe4