ric8b

Ensembl ID:
ENSDARG00000005972
ZFIN IDs:
ZDB-GENE-030131-6435, ZDB-GENE-030131-6435
Description:
Synembryn-B [Source:UniProtKB/Swiss-Prot;Acc:Q6DRJ9]
Human Orthologue:
RIC8B
Human Description:
resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) [Source:HGNC Symbol;Acc:25555]
Mouse Orthologue:
Ric8b
Mouse Description:
resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1716 Nonsense Confirmed mutation in F2 line During 2014
sa13369 Essential Splice Site Available for shipment Available now
sa17855 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1716
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019818 Nonsense 200 536 3 10
ENSDART00000091428 Nonsense 200 282 3 5
Genomic Location:
Chromosome 18 (position 14906968)
KASP Assay ID:
554-1662.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACGCTTCAGAAGGAGGCAGGCGCGGTGAAACTACTCACTAATGTGT[T/A]GGAACGCACTCTTGATGTGCGTTGGGTTGGGCCATATGAGGCTGCACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019818 Essential Splice Site 413 536 7 10
ENSDART00000091428 None None 282 None 5
Genomic Location:
Chromosome 18 (position 14897642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAACAGGGGGCTGCTGAGTTCCTGTTTGTGCTCTGCAAGGAGAGTGG[T/A]AAGTTCTGCTTCAYAATGGTGCAGTTTTATACATAATAGTTTTCATACTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019818 Nonsense 455 536 8 10
ENSDART00000091428 None None 282 None 5
Genomic Location:
Chromosome 18 (position 14895553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGAGAGACGCAGTACTCRTCTGATGAAGACTCTGACACTGAGGAGTA[C/A]AAGTCYGTCAAACCATTGTAAGTGCCTTTTTGTGTATGCATAACNTTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eh0luxfm