ric8b

Ensembl ID:
ENSDARG00000005972
ZFIN IDs:
ZDB-GENE-030131-6435, ZDB-GENE-030131-6435
Description:
Synembryn-B [Source:UniProtKB/Swiss-Prot;Acc:Q6DRJ9]
Human Orthologue:
RIC8B
Human Description:
resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) [Source:HGNC Symbol;Acc:25555]
Mouse Orthologue:
Ric8b
Mouse Description:
resistance to inhibitors of cholinesterase 8 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36603 Nonsense Mutation detected in F1 DNA During 2016
sa1716 Nonsense Confirmed mutation in F2 line During 2016
sa36602 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13369 Essential Splice Site Available for shipment Available now
sa17855 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019818 Nonsense 139 536 3 10
ENSDART00000091428 Nonsense 139 282 3 5
Genomic Location (Zv9):
Chromosome 18 (position 14907152)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15352570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCCTTAAGTGCCTGTGCAACGTAGTGTTCAATAGCGTGCCGGCACAG[C/T]AGATGGGAGGTGACTTGCAGTTAGCGGAAGGCCTATGCCCCCGCTTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1716
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019818 Nonsense 200 536 3 10
ENSDART00000091428 Nonsense 200 282 3 5
Genomic Location (Zv9):
Chromosome 18 (position 14906968)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15352386
KASP Assay ID:
554-1662.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACGCTTCAGAAGGAGGCAGGCGCGGTGAAACTACTCACTAATGTGT[T/A]GGAACGCACTCTTGATGTGCGTTGGGTTGGGCCATATGAGGCTGCACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019818 Essential Splice Site 282 536 4 10
ENSDART00000091428 Essential Splice Site 282 282 4 5
Genomic Location (Zv9):
Chromosome 18 (position 14904589)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15350007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTAATGCTGAAAACACACACTGAAGAAAAAACTGAGGAGACTCACAGG[T/C]ACTTCCAAACTAGGGCTGCACGTTATTGGAAAAATCTGATATTGCCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019818 Essential Splice Site 413 536 7 10
ENSDART00000091428   None 282 None 5
Genomic Location (Zv9):
Chromosome 18 (position 14897642)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15343060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAACAGGGGGCTGCTGAGTTCCTGTTTGTGCTCTGCAAGGAGAGTGG[T/A]AAGTTCTGCTTCAYAATGGTGCAGTTTTATACATAATAGTTTTCATACTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019818 Nonsense 455 536 8 10
ENSDART00000091428   None 282 None 5
Genomic Location (Zv9):
Chromosome 18 (position 14895553)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15340971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGAGAGACGCAGTACTCRTCTGATGAAGACTCTGACACTGAGGAGTA[C/A]AAGTCYGTCAAACCATTGTAAGTGCCTTTTTGTGTATGCATAACNTTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link