ankmy2a

Ensembl ID:
ENSDARG00000005948
ZFIN ID:
ZDB-GENE-030131-6321
Description:
ankyrin repeat and MYND domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_956188]
Human Orthologue:
ANKMY2
Human Description:
ankyrin repeat and MYND domain containing 2 [Source:HGNC Symbol;Acc:25370]
Mouse Orthologue:
Ankmy2
Mouse Description:
ankyrin repeat and MYND domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2144755]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22692 Essential Splice Site Available for shipment Available now
sa19120 Nonsense Mutation detected in F1 DNA During 2014
sa17236 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003674 Essential Splice Site 177 421 5 11
Genomic Location:
Chromosome 15 (position 33882527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACCGCTACACAAAATTATCATGAGTACCAACCTCAATCCTGTAAAGG[T/C]ATCAGGCCATGTTTTCTTTTCCAGTCCTGTTCATTTCTCTCCTTTCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003674 Nonsense 293 421 8 11
Genomic Location:
Chromosome 15 (position 33876353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGATGCCACATTACTTCAGCAGCTGGTCCGGAGTATCGCTCCAGTG[G/T]AAATTGTGAGTAAGAGTTACAGAGACCTCTGTTTGCTCACGTAGAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003674 Essential Splice Site 294 421 8 11
Genomic Location:
Chromosome 15 (position 33876346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCACATTACTTCAGCAGCTGGTCCGGAGTAWCGCTCCAGTGGAAATTG[T/A]GAGTAAGAGTTACAGAGACCTCYGTTTGCTCACKTAGAGGTAAATCTACY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bb7kggys