ankmy2a

Ensembl ID:
ENSDARG00000005948
ZFIN ID:
ZDB-GENE-030131-6321
Description:
ankyrin repeat and MYND domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_956188]
Human Orthologue:
ANKMY2
Human Description:
ankyrin repeat and MYND domain containing 2 [Source:HGNC Symbol;Acc:25370]
Mouse Orthologue:
Ankmy2
Mouse Description:
ankyrin repeat and MYND domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2144755]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22692 Essential Splice Site Available for shipment Available now
sa17236 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003674 Essential Splice Site 177 421 5 11
Genomic Location (Zv9):
Chromosome 15 (position 33882527)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34728303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACCGCTACACAAAATTATCATGAGTACCAACCTCAATCCTGTAAAGG[T/C]ATCAGGCCATGTTTTCTTTTCCAGTCCTGTTCATTTCTCTCCTTTCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003674 Essential Splice Site 294 421 8 11
Genomic Location (Zv9):
Chromosome 15 (position 33876346)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34722122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCACATTACTTCAGCAGCTGGTCCGGAGTAWCGCTCCAGTGGAAATTG[T/A]GAGTAAGAGTTACAGAGACCTCYGTTTGCTCACKTAGAGGTAAATCTACY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link