sart1

Ensembl ID:
ENSDARG00000005945
ZFIN ID:
ZDB-GENE-040718-422
Description:
U4/U6.U5 tri-snRNP-associated protein 1 [Source:RefSeq peptide;Acc:NP_001002673]
Human Orthologue:
SART1
Human Description:
squamous cell carcinoma antigen recognized by T cells [Source:HGNC Symbol;Acc:10538]
Mouse Orthologue:
Sart1
Mouse Description:
squamous cell carcinoma antigen recognized by T-cells 1 Gene [Source:MGI Symbol;Acc:MGI:1309453]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43660 Nonsense Mutation detected in F1 DNA During 2017
sa23955 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012855 Nonsense 219 777 6 20
Genomic Location (Zv9):
Chromosome 21 (position 26700601)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27269512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCCTCGAGGAGATGGATGAAGAGTTCGGTGTGAGCAATCTTGTCGAG[C/T]AGGAGTTTGCACAGGAGAAGCGGGTGTGTGATTTTGATTTTGCTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012855 Nonsense 293 777 8 20
Genomic Location (Zv9):
Chromosome 21 (position 26703095)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27272006
KASP Assay ID:
2261-5708.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGAAGGCAGAGAAAAACGTGGAGCTGAAGAAAAAGAAGCCAGATTA[T/A]AAACCATACGAAGAAGAGGAGAGTGTGGATGACATGATCGTTGTAAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link