tbc1d17

Ensembl ID:
ENSDARG00000005927
ZFIN ID:
ZDB-GENE-050522-79
Description:
TBC1 domain family member 17 [Source:RefSeq peptide;Acc:NP_001019565]
Human Orthologue:
TBC1D17
Human Description:
TBC1 domain family, member 17 [Source:HGNC Symbol;Acc:25699]
Mouse Orthologue:
Tbc1d17
Mouse Description:
TBC1 domain family, member 17 Gene [Source:MGI Symbol;Acc:MGI:2449973]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33193 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017422 Essential Splice Site 107 639 4 17
ENSDART00000077057 Essential Splice Site 107 582 4 16
ENSDART00000134395 Essential Splice Site 107 582 4 16
Genomic Location (Zv9):
Chromosome 3 (position 30333889)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30051928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCAAGCAGGACAGACGGCAGGAGCAGCCACCGGTCAGAGAAACCGG[T/C]ATTGCGTTAAACCCACACTAGTCAAAATGATACATCTCATGCATTTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link