tbc1d17

Ensembl ID:
ENSDARG00000005927
ZFIN ID:
ZDB-GENE-050522-79
Description:
TBC1 domain family member 17 [Source:RefSeq peptide;Acc:NP_001019565]
Human Orthologue:
TBC1D17
Human Description:
TBC1 domain family, member 17 [Source:HGNC Symbol;Acc:25699]
Mouse Orthologue:
Tbc1d17
Mouse Description:
TBC1 domain family, member 17 Gene [Source:MGI Symbol;Acc:MGI:2449973]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5208 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017422 Essential Splice Site 410 639 11 17
ENSDART00000077057 None None 582 None 16
ENSDART00000134395 None None 582 None 16
Genomic Location:
Chromosome 3 (position 30326132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCTCCATGATGTGTTGATGACGTACTGCATGTACAATTTTGATCTAG[G/A]TAGGAGCAAGTGATTTGTTGTTGTAATTCCAYCTGCTYACCACTAGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vj00912c