LOC566605

Ensembl ID:
ENSDARG00000005916
Human Orthologue:
SRPK3
Human Description:
SRSF protein kinase 3 [Source:HGNC Symbol;Acc:11402]
Mouse Orthologue:
Srpk3
Mouse Description:
serine/arginine-rich protein specific kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1891338]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18907 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004279 Essential Splice Site 631 691 15 16
Genomic Location:
Chromosome 8 (position 8881419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTCGCTCTGTCAGGCAGATACTCCAGAGAATACTTCAACCGGAGAGG[T/C]ACCAGCTCAGCATGAGAAAAGTCTAAATTATGACTTCAAAAGTTGAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jjyrxasb