tcf3

Ensembl ID:
ENSDARG00000005915
ZFIN IDs:
ZDB-GENE-990415-51, ZDB-GENE-990415-51
Description:
transcription factor 3 [Source:RefSeq peptide;Acc:NP_571169]
Human Orthologue:
TCF3
Human Description:
transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Tcf3
Mouse Description:
transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:98510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39955 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020529 Essential Splice Site 302 557 13 18
ENSDART00000078298 Essential Splice Site 227 470 10 15
Genomic Location (Zv9):
Chromosome 2 (position 57792499)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57183429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCATGCAGTGTCAGGCTTCTCTAACATCTGTGTTTGTTTGTGTTTTC[A/T]GCCTCTGCATCTCAGTGGCCCAAAGGCTCCTCTCAGCCTGCGCCATCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link