tcf3

Ensembl ID:
ENSDARG00000005915
ZFIN IDs:
ZDB-GENE-990415-51, ZDB-GENE-990415-51
Description:
transcription factor 3 [Source:RefSeq peptide;Acc:NP_571169]
Human Orthologue:
TCF3
Human Description:
transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Tcf3
Mouse Description:
transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:98510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5174 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020529 Essential Splice Site 62 557 3 18
ENSDART00000078298 None None 470 None 15
Genomic Location:
Chromosome 2 (position 57820813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGGCTCCTGGGGTTCAGAAGCAAACAGTCCTTCATTCGGCGCACGGG[T/G]ATGAACACACACACNNNCACACACAGAGATAACGTCTCTGGTGAAGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cd6sm9ha