LOC793448

Ensembl ID:
ENSDARG00000005913
Human Orthologue:
TGM1
Human Description:
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) [So
Mouse Orthologue:
Tgm1
Mouse Description:
transglutaminase 1, K polypeptide Gene [Source:MGI Symbol;Acc:MGI:98730]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19336 Nonsense Mutation detected in F1 DNA During 2014
sa9842 Nonsense Available for shipment Available now
sa19337 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9467 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041912 Nonsense 240 689 5 12
ENSDART00000041912 Nonsense 240 689 5 12
Genomic Location:
Chromosome 23 (position 40510739)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCACACAGGTTAATGCCAATGATGACTCTGGTGTGTTGATGGGCAACT[G/A]GTCGAACTGCTATGCGGACGGGACTGCTCCAACAGCCTGGTGTGGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041912 Nonsense 240 689 5 12
ENSDART00000041912 Nonsense 240 689 5 12
Genomic Location:
Chromosome 23 (position 40510739)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCACAYAGGTTAATGCCAATGATGACTCTGGTGTGTTGATGGGCAACT[G/A]GTCGAACTGCTATGCGGACGGGACTGCTCCAACAGCCTGGTGTGGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041912 Essential Splice Site 642 689 11 12
ENSDART00000041912 Essential Splice Site 642 689 11 12
Genomic Location:
Chromosome 23 (position 40521268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGCATTGAGGGACTGGGTCTGAAGCACTGCAGATCCATCAACTATGG[G/A]TAGGAAATTGAGTGTTACATTATATGTGACCCTGGATCACAAAACCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041912 Essential Splice Site 642 689 11 12
ENSDART00000041912 Essential Splice Site 642 689 11 12
Genomic Location:
Chromosome 23 (position 40521268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCGCATTGARGGACTGGGTCTGAAGCACTGCAGATCCATCAACTATGG[G/A]TAGGAAATTGAGTGTTACATTATATGTGACCCTGGATCACAAAACCAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gowp1jds