clk4b

Ensembl ID:
ENSDARG00000005908
ZFIN ID:
ZDB-GENE-050227-19
Description:
CDC-like kinase 4b [Source:RefSeq peptide;Acc:NP_001013312]
Human Orthologues:
CLK1, CLK4
Human Descriptions:
CDC-like kinase 1 [Source:HGNC Symbol;Acc:2068]
CDC-like kinase 4 [Source:HGNC Symbol;Acc:13659]
Mouse Orthologues:
Clk1, Clk4
Mouse Descriptions:
CDC like kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1098551]
CDC-like kinase 1 Gene [Source:MGI Symbol;Acc:MGI:107403]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37351 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129939 Nonsense 145 479 3 12
ENSDART00000139890 Nonsense 145 479 4 13

The following transcripts of ENSDARG00000005908 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31052624)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32252094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAAAGAACCAAGAGTATTGAGGATGATGAGGAGGGTCACCTGGTCTA[T/G]CACAATGGAGACATGCTAAGAGCAAGATGTATAGAACACAACCCTTTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link