LOC571099

Ensembl ID:
ENSDARG00000005901
Human Orthologue:
AIM1L
Human Description:
absent in melanoma 1-like [Source:HGNC Symbol;Acc:17295]
Mouse Orthologue:
Aim1l
Mouse Description:
absent in melanoma 1-like Gene [Source:MGI Symbol;Acc:MGI:1334463]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3003 Essential Splice Site F2 line generated During 2014
sa11766 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3003
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013972 Essential Splice Site 296 702 9 19
Genomic Location:
Chromosome 19 (position 50051359)
KASP Assay ID:
554-2512.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGGCGGAGTCAACTMTGAGCTGCGCTCCGTCAGAGTCATTCAGTCGG[T/G]AAGAAACATCTACRCTSAGCACATACACRCATTTCAGCAGCCATCAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013972 Essential Splice Site 436 702 14 19
Genomic Location:
Chromosome 19 (position 50047204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCAATGGAGCTGAATCCTAATTGTGATTGTAAACCTGTGTTTATTTC[A/G]GCTGGGTGCTGTAYGGAGAAGMGAAGTTCAGCGGCAGCATGTATGTYTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0e4c2i66