cyb5r3

Ensembl ID:
ENSDARG00000005891
ZFIN ID:
ZDB-GENE-030131-3281
Description:
NADH-cytochrome b5 reductase 3 [Source:RefSeq peptide;Acc:NP_997850]
Human Orthologue:
CYB5R3
Human Description:
cytochrome b5 reductase 3 [Source:HGNC Symbol;Acc:2873]
Mouse Orthologue:
Cyb5r3
Mouse Description:
cytochrome b5 reductase 3 Gene [Source:MGI Symbol;Acc:MGI:94893]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31384 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014153 Essential Splice Site 179 298 6 9
Genomic Location (Zv9):
Chromosome 4 (position 10873660)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11810287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGTGATAAAAACTGCTAAACATGTTGGCATGATTGCTGGGGGAACAG[G/A]TGAGCACATGGTTCCTACATTTGAGTTTAAGTTTGGAATGCAATAAACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link