rfx1a

Ensembl ID:
ENSDARG00000005883
ZFIN ID:
ZDB-GENE-070424-94
Description:
MHC class II regulatory factor RFX1 [Source:RefSeq peptide;Acc:NP_001083022]
Human Orthologue:
RFX1
Human Description:
regulatory factor X, 1 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9982]
Mouse Orthologue:
Rfx1
Mouse Description:
regulatory factor X, 1 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:105982]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6031 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33136 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012335   None 897 None 18
ENSDART00000129205 Essential Splice Site 364 908 5 17
ENSDART00000131503   None 256 None 5

The following transcripts of ENSDARG00000005883 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 19002438)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19030800
KASP Assay ID:
554-3967.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTATAAATGAAGGCGAGGACAATAGCGTGCCGTCGGCAGACAAAAAG[G/A]TATGACGACAACAGGGGGCGGMGCTTAATCGTCACCCATCGCCACTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012335 Essential Splice Site 454 897 8 18
ENSDART00000129205 Essential Splice Site 465 908 7 17
ENSDART00000131503   None 256 None 5

The following transcripts of ENSDARG00000005883 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 18994118)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19022480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCAGCACCTGGCCATGAGACAGCAGCCCTTCTCCCAGAAACAGAGG[T/C]GAACACTCATGCTCTCTGTCAGTTCTCACTGTCAGTCTCTCCCTGGATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link