mmadhc

Ensembl ID:
ENSDARG00000005870
ZFIN ID:
ZDB-GENE-040704-50
Description:
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria [Source:RefSeq peptide
Human Orthologue:
MMADHC
Human Description:
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria [Source:HGNC Symbol;Acc
Mouse Orthologue:
Mmadhc
Mouse Description:
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21479 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012478 Nonsense 281 297 8 8
ENSDART00000125370 None None 188 9 9
Genomic Location:
Chromosome 9 (position 24089084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCATGTGATGTGGGGGACACACGCTTTTGTAGGTACTCTTTTCACCT[C/A]GGCTCCACCCAACAGCCAGATCATGAAGAAGCTACAAGGGGACCTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cwozdwwm