RALGAPA2

Ensembl ID:
ENSDARG00000005861
Description:
Ral GTPase activating protein, alpha subunit 2 (catalytic) [Source:HGNC Symbol;Acc:16207]
Human Orthologue:
RALGAPA2
Human Description:
Ral GTPase activating protein, alpha subunit 2 (catalytic) [Source:HGNC Symbol;Acc:16207]
Mouse Orthologue:
Ralgapa2
Mouse Description:
Ral GTPase activating protein, alpha subunit 2 (catalytic) Gene [Source:MGI Symbol;Acc:MGI:3036245]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17672 Nonsense Available for shipment Available now
sa42984 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084745 Nonsense 1618 1916 33 41
Genomic Location (Zv9):
Chromosome 17 (position 41698865)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41594275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGGAGGCYGTCCACMGACAGTCAAAACAGGAGGAAGAGGAGTTGATG[C/T]GAAGGCAAATYGAAGACCCCARTGTCAGAGCAGAGAGGCAGARAGAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084745 Nonsense 1716 1916 35 41
Genomic Location (Zv9):
Chromosome 17 (position 41687224)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41582634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAGGACAAATATTCCATTCTGTCCAATACACAGGGCAGTCAGGTTTA[T/A]GAGGACTTTGTCTCTGGACTGGGATGGGAGGTGAAATAACACACAAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link